86
|
Jackson Laboratory
mice omp cre mice Mice Omp Cre Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mice+omp+cre+mice/heterozygous+mice/bio_rxiv__64898__2026__04__30__721772-210-18-23 Average 86 stars, based on 1 article reviews
mice omp cre mice - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
90
|
BioResource International Inc
omp-cre mouse line Omp Cre Mouse Line, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mice+omp+cre+mice/omp+cre+mouse+line/pmc11633753-187-2-10 Average 90 stars, based on 1 article reviews
omp-cre mouse line - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
92
|
Addgene inc
cgcataaccagtgaaacagca 3 Cgcataaccagtgaaacagca 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mice+omp+cre+mice/pLenti-Synapsin-hChR2(H134R)-EYFP-WPRE+(Plasmid+%2320945)/pm38670072-281-214-225 Average 92 stars, based on 1 article reviews
cgcataaccagtgaaacagca 3 - by Bioz Stars,
2026-11
92/100 stars
|
Buy from Supplier |
90
|
Johns Hopkins HealthCare
omp-cre mice  Omp Cre Mice, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mice+omp+cre+mice/oc+cre+mice/pmc07452722-30-7-19 Average 90 stars, based on 1 article reviews
omp-cre mice - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
86
|
Jackson Laboratory
to either gt rosa To Either Gt Rosa, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mice+omp+cre+mice/26sortm14+b6+cag+cg+gt+hze+j+rosa+tdtomato/pmc12664895-432-17-24 Average 86 stars, based on 1 article reviews
to either gt rosa - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
86
|
Jackson Laboratory
mouse omp Mouse Omp, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mice+omp+cre+mice/129s7+b6+j+rag1tm1mom/pmc12664895-13-0-4 Average 86 stars, based on 1 article reviews
mouse omp - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
90
|
Bamomab GmbH
antibody mouse monoclonal anti-mica Antibody Mouse Monoclonal Anti Mica, supplied by Bamomab GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mice+omp+cre+mice/anti+mica++amo1+/10__7554_slash_elife__74489-335-121-126 Average 90 stars, based on 1 article reviews
antibody mouse monoclonal anti-mica - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
mouse anti-human pan mic Mouse Anti Human Pan Mic, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mice+omp+cre+mice/pe+mouse+anti+human+mic+a+b/pm24184557-55-25-31 Average 90 stars, based on 1 article reviews
mouse anti-human pan mic - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
TSUMURA
tsod mice Tsod Mice, supplied by TSUMURA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mice+omp+cre+mice/tsod+mice/pm39572891-62-6-10 Average 90 stars, based on 1 article reviews
tsod mice - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
ApexBio
edu apexbio Edu Apexbio, supplied by ApexBio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mice+omp+cre+mice/edu/pm39477931-325-16-1 Average 90 stars, based on 1 article reviews
edu apexbio - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
86
|
Amaxa
mice Mice, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mice+omp+cre+mice/mice/pm34556881-500-8-12 Average 86 stars, based on 1 article reviews
mice - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
86
|
Amgen
mice Mice, supplied by Amgen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mice+omp+cre+mice/mice/pm37265402-43-1-4 Average 86 stars, based on 1 article reviews
mice - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
Image Search Results
Journal: eLife
Article Title: The role of the NMD factor UPF3B in olfactory sensory neurons
doi: 10.7554/eLife.57525
Figure Lengend Snippet:
Article Snippet: Genetic reagent ( Mus. musculus ) ,
Techniques: Generated, Sequencing, cDNA Synthesis, SYBR Green Assay, Software